Demonstration of retinal afferents in the RCS rat,with reference to the retinohypothalamic projection and suprachiasmatic nucleus

In the Royal College of Surgeons (RCS) rat, characterized by inherited retinal dystrophy, retinal projections to the brain were studied using anterograde neuronal transport of cholera toxin B subunit upon injection into one eye. The respective immunoreactivity was found predominantly contralateral to the injection site in the lateral geniculate nucleus, superior colliculus, nucleus of the optic tract, medial terminal nucleus of the accessory optic tract, and bilateral hypothalamic suprachiasmatic nuclei. Although terminal density was somewhat reduced in dystrophic rats, the projection patterns in these animals appeared similar to those seen in their congenic controls and were comparable to the visual pathways described for the rat previously. In dystrophic rats, the number of cell bodies exhibiting immunoreactivity to vasoactive intestinal polypeptide, viz. a population of suprachiasmatic neurons receiving major retinohypothalamic input, was reduced by one-third, and some differences were observed in the termination pattern of the geniculohypothalamic tract, as revealed by immunoreactivity to neuropeptide Y in the suprachiasmatic nucleus.This study was supported by grants from the DFG (Re 644/2-1) and the NMFZ, Mainz (to S.R.).     

Excess of deletions of maternal origin in the DiGeorge/Velo-cardio-facial syndromes. A study of 22 new patients and review of the literature

We have determined the parental origin of the deleted chromosome 22 in 29 cases of DiGeorge syndrome (DGS) using a CA-repeat mapping within the commonly deleted region, and in one other case by using a chromosome 22 short arm heteromorphism. The CA-repeat was informative in 21 out of 29 families studied and the deleted chromosome was of maternal origin in 16 cases (72%). When these data are pooled with recent results from the literature, 24 de novo DGS, velo-cardio-facial syndrome (VCFS) and isolated conotruncal cardiac disease deletions are found to be of maternal origin and 8 of paternal origin, yielding a ² of 8 with a probability level lower than 0.01. These data, and review of the literature on familial DGS/VCFS and isolated conotruncal cardiopathies suggest that there is a strong tendency for the 22q11.2 deletions to be of maternal origin.     

Multiple modes of ligand recognition: Crystal structures of cyclin-dependent protein kinase 2 in complex with ATP and two inhibitors,olomoucine and isopentenyladenine

Cyclin-dependent kinases (CDKs) are conserved regulators of the eukaryotic cell cycle with different isoforms controlling specific phases of the cell cycle. Mitogenic or growth inhibitory signals are mediated, respectively, by activation or inhibition of CDKs which phosphorylate proteins associated with the cell cycle. The central role of CDKs in cell cycle regulation makes them a potential new target for inhibitory molecules with anti-proliferative and/or anti-neoplastic effects. We describe the crystal structures of the complexes of CDK2 with a weakly specific CDK inhibitor, N6-(δ2-isopentenyl)adenine, and a strongly specific inhibitor, olomoucine. Both inhibitors are adenine derivatives and bind in the adenine binding pocket of CDK2, but in an unexpected and different orientation from the adenine of the authentic ligand ATP. The N6-benzyl substituent in olomoucine binds outside the conserved binding pocket and is most likely responsible for its specificity. The structural information from the CDK2-olomoucine complex will be useful in directing the search for the next generation inhibitors with improved properties. © 1995 Wiley-Liss, Inc.     

Argyrophilic nucleolar organizer regions

Silver staining techniques developed to demonstrate argyrophilic nucleolar organizer regions (Ag-NORs) have been widely applied in a variety of cell kinetic studies, using the mean number of AgNORs in tumour cells as a marker for malignancy of certain types of neoplasms. However, the AgNOR techniques currently available are not entirely satisfactory, as unspecific silver precipitates readily form in the sections. On the other hand, the contrast staining, may be so weak as to render identification of the AgNORs difficult. In the present study, some of the key factors influencing the outcome of AgNOR staining were evaluated in a more systematic way. A modified AgNOR staining procedure is now proposed, giving highly contrasting AgNORs with minimal unspecific silver precipitation, thus facilitating both manual and computerized counting. The new technique involves the use of microwave irradiation in order to shorten the processing time, the use of gelatin as a protective colloid, and a Farmer's solution to optimize the specificity of the technique.     

Elimination of the yeastCandida parapsilosis from lymphoid cells and monolayer cells in culture

Summary In our laboratory, airborne yeast contaminants of cell cultures have consistently been of the genusCandida (speciesCandida parapsilosis), which are difficult to control with fungicidal agents. To salvage cell lines that show the presence of this fungus, two effective methods may be employed. In early stages of infection, the addition of activated mouse peritoneal macrophages (5×10⁵ cells/ml) to the culture medium containing 5 μg Fungizone/ml eliminates all spores by phagocytosis. More heavily contaminated cultures can be depleted of fungi by density centrifugation on a layer of 38% Percoll. Remaining single spores, often not detectable by light microscopy, can be removed by the addition of macrophages (2×10⁵/ml) and Fungizone (5 μg/ml) to the culture medium. Contaminated monolayer cells can be freed of blastospores by several washes with balanced salt solution and subsequent culturing for 4 d in medium containing 10 μg Fungizone/ml without any toxic effects to the cells. These procedures can rescue valuable cell lines and hybridomas that would otherwise be lost. This work was supported by Veterans Administration Research Funds.     

Selective excitation of mithramycin or DAPI fluorescence on double-stained cell nuclei and chromosomes

Summary Fluorescence spectra of leukocytes stained by both mithramycin and DAPI showed that the fluorescence of the two dyes can be separated efficiently by using different excitation wavelengths, for instance the 435 nm and the 365 nm mercury lines. In human chromosomes the complementary (reverse) banding pattern produced by these dyes may thus be observed on double stained chromosome spreads. In plants, for instance in Anemone blanda, the two dyes may reveal two different banding patterns. The results of absorption and fluorescence measurements suggest the existence of at least two binding sites, or types, for each dye, with different fluorescent yields and binding strengths.     

Cytomorphogenetic- and anti-microtubule action of the antibiotic gougerotin inMicrasterias denticulata Bréb.

Summary Differentiating cells ofMicrasterias denticulata have been treated with aqueous solutions of the antibiotic gougerotin. Strong and characteristic cytomorphogenetic aberrations, resembling those of the anuclear type of development could be observed. It has been speculated that the aberrant growth of the growing half cell is the result of inhibition of protein synthesis by gougerotin.In addition to the morphogenetic influence, nuclear migration has been strongly inhibited by the drug. Therefore, it might be suggested that gougerotin is an active anti-microtubule agent.     

Erythropoiesis in normal and mutant chick embryos

Hemoglobin D_Davis (Hb D_D), an autosomal codominant in chickens, the α^D-globin chain of Hb M of primitive cells and Hb D of definitive erythrocytes. Erythropoiesis and Hb synthesis was investigated in normal, heterozygous, and homozygous Hb D_D mutant embryos (stages 15–44) and adults. The time of appearance, morphology, relationships to developmental changes, and number of primitive and definitive cells were determined. Primitive hemoglobins between stages 17 and 44 showed four components, P1, P2, E, and M (or M_D), on high-resolution isoelectric focusing gels. Comparison of $\text{P1}\text{P2}$ ratios in the four phenotypes indicated that homozygous Hb D_D embryos had an increased proportion of Hb P2 relative to Hb P1 between stages 17 and 35. This difference coincided with an increase in the number of large primitive cells. In all phenotypes the proportions of primitive hemoglobins decreased after stage 25 and they were not detected after stage 40. Basophilic definitive erythroblasts were present in cell suspensions from all phenotypes between stages 24 and 25. Hb A, the major Hb and Hb D, the minor Hb, of definitive cells of embryos and adults were detected by isoelectric focusing of lysates by stage 29. Definitive cells from late embryos of all phenotypes had higher proportions of Hb D (or Hb D_D) than did red cells from corresponding adult birds. Heterozygous Hb D_D embroys and adults had both Hb D and Hb D_D. Hb D_D comprises about 30% of the total minor Hb rather than 50% expected for heterozygosity at a single locus. In this respect heterozygous Hb D_D chick embryos and adult birds are similar to certain heterozygous α-chain variants in humans. A minor Hb, H, found in lysates of later embryos disappears in lysates of normal chicks 65 days after hatching, but was present in the circulation of homozygous Hb D_D chicks until at least 195 days after hatching. Additionally, several minor Hb components which may be asymmetrical hybrids or derived precursors of Hb A and Hb D (or Hb D_D) were observed. This study provides the precise developmental stages when the switchover of erythroid cell populations and hemoglobins in the chick embryo occurs. This is the first investigation of an α-globin chain mutant which is synthesized during all stages of red cell development and may be a useful animal model for the study of hemoglobinopathies in vertebrates.     

Tissue specific nuclear antigens in the germinal vesicle ofXenopus laevis oocytes

Summary A library of hybridoma cell lines has been established which produce monoclonal antibodies against antigens from the germinal vesicle ofXenopus laevis oocytes. Many of the antigens are also found in the nuclei ofXenopus embryonic cells in culture. The fate of two of these antigens during embryogenesis was traced by immunofluorescence on embryo and tadpole sections. Early in development these antigens appear to be evenly distributed in the nuclei of all cells. In later stages they gradually disappear from most embryonic structures but are strongly accumulated in the nuclei of some specific cell types and organs.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.